The Piltdown Hoax

                The Piltdown Man was a fossil discovery that fooled scientist for decades. The fossils were found in the small village of Piltdown in England by a man names Charles Dawson in the early 1900’s. He was an amateur archeologist that specialized in fish fossils, not human evolution. Though there is not a definitive hoaxer he is the person most people blame for the deception. He also worked with a geologist named Sir Arthur Smith Woodward. These two sent their finds to the Britain Natural History Museum and it became a well-known and famous find. They claimed the fossils they found were a perfect connection between humans and apes. The jaw bone was more like an ape but the teeth had a very human like wear to them. This supported some scientists’ views that we evolved a bigger brain before we started to walk upright. This was a huge discovery for Britain as well given that they had not had any early human fossils in their country. The fossils gave them a sense of pride that they found the earliest human in their own homeland. The fossils were kept in the museum and were not available to many people for research. Later there was a chemical test developed to test the age of fossils more accurately. This test showed that the Piltdown Man was in fact much younger than advertised. This called for more research to be done on the fossils which revealed more and more inconsistences. The bones had been dyed to look older and the teeth had been filed down to look like human teeth. The jaw bone was in fact just a female orangutan that was less than 100 years old and the skull bones did not match at all. They were pieced together to make a perfect puzzle.  All of this came to light due to better dating and aging tests.

                The fraud had been brought to light so many years after the public and scientific community had accepted the fossils as truth that the aftermath was devastating. The country as a whole felt duped and embarrassed. There had been many scientists that studied the bones for their career and never knew they were faked. The discovery of the lies caused many to question the authenticity of scientist. People started to think that it was incredibly easy to trick them and therefore any finds they make must be fake somehow. This deception caused many to doubt the scientific method and its results. People tend to forget that it was science that proved it to be a fake as well. Yes the scientists were fooled but the technology advanced and they were able to see the lies.

                Scientist are curious by nature but they do make human mistakes as well. In this scenario people were so excited to finally find such a significant evolutionary discovery that they might have overlooked some key information. People had started to doubt the Piltdown Man before the discovery was made public but some scientists never wanted to believe it. In many situations the fossils gave the scientists exactly what they wanted. The finds supported their hypothesis and they did not want it to change. It is human of us to make mistakes but that does not make it wrong. As a species humans have a thirst for knowledge. We are curious about who we are and where we come from. It is this motivation that drives science. If you take away the “humanness” then you potentially take away the drive to learn more.

                The scientific technology had advanced enough to allow them to identify the fraud. The use of chemicals was able to show that the bones were much younger than the half a million years old they had originally thought. They also used microscopes to see the scratches made when filling down the teeth and canine. They were able to see the bones in better detail and see that they had been broken or shaped to fit together.

                We can all learn from this situation. When we are given information that seems too good to be true we might need to consider the source and do some additional research. Even if the information given to us perfectly supports our own endeavors, we need to make sure they are true. Science is ever changing and technologies are growing. This can help us or hurt us, we just need to be sure of the information we are given. 

Comparitive Primates

There are two suborder of primates; the Strepsirhini, which include lemurs and lorises, and the Haplorhini, which include tarsiers, monkeys, apes, and humans. All of these primates have many similarities and differences. In my post I will be focusing of the locomotor patterns that these primates exhibit.

       Lemurs live on the island of Madagascar and off the east coast of Africa. There is a lot of variation that lemurs show in their locomotor patterns. The picture showed here is of a ring-tailed lemur which happen to be terrestrial. There are a great deal more of arboreal lemurs given to the many high trees in Madagascar. This means that most lemurs prefer to be in the trees and travel that way. Even within the arboreal lemur family though there is some variation as to how they climb. Some are quadrupeds while others are vertical clingers and leapers. Quadrupeds use all four of their limbs to support their body weight while moving. Vertical clingers and leapers also use all four of their limbs but they use them to support their body weight vertically.The lemurs are the only non human primates on Madagascar, therefore they had no competition. This created a very unique set of primates.

        The spider monkey is a New World monkey. They mostly live in forested environments through southern Mexico and Central and South America. Because this is a mostly arboreal environment most of these monkeys live in the trees and some never touch the ground. The spider monkey is what they call a "semibrachiator". This means that this monkey uses both swinging by its arms and leaping to move about the forest. They also have a "prehensile tail" that they use as a kind of fifth arm. you can see this in the picture to the right. Due to the arboreal environment that they live in, these monkeys have adapted to live in the trees and use their limbs to help them. The spider monkey has even adapted to use its long tail to help him move.

     The Baboon is an Old World monkey. These monkeys are extremely spread out in the types of environments they live in. Baboons are part of the cercopithecines subfamily and are mainly found in Africa. The Baboon is a terrestrial monkey that only goes to the tress at night. They are quadrupedal so they walk on all four limbs. They lack a tail so they are very different from the spider monkey in their locomotor patterns. Given that the baboon does not spend a great deal of time in the trees it is understandable that they have adapted to their environment and are quadrupedal instead of using brachiation.

    Gibbons and Siamangs are considered the lesser apes because they are the smallest of the apes. They live in Southeast Asia along with the Orangutans. Gibbons travel almost exclusively using Brachiation. They use their arms to swing them from branch to branch. They are one of the only primates to excel at this form of travel. As you can see in the picture to the right, they have much longer arms. This helps them in their swinging ability. Their arms are so much longer in fact that when they do walk on the ground they need to walk bipedally. These apes have adapted and evolved to use their arms in the most beneficial way possible, which led to their extremely long arms.

 Chimpanzees, and Gorillas, are considered the great apes. The chimpanzees are found in equatorial Africa from the Atlantic Ocean to the Lake Tanganyika. Given their wide range of environments the chimpanzee walks quadrupedally but also occasionally climbs trees. Young chimpanzees have been known to brachiate on occasion. They are known as knuckle walkers as well as the gorillas given that when they walk on all four limbs they walk on their knuckles. Chimpanzees have also been known to walk bipedally if they are walking short distances while holding something.  They are built very similar to that of gorillas except that they have adapted in different ways. They spend more time in the trees and have adapted and evolved accordingly as you can see by their difference in locomotor patterns.

Homologous and Analogous Traits

Humans and dolphins share the same homologous trait in the structure of their bones in their outer limbs. These two structures perform very different tasks and are laid out in a different way but the key structure is the same. They share the same bones such as a humerus, ulna, and phalanges. While humans use their hands, and the bones in them, to grab items and write; the dolphin uses the bones in their pectoral fins to turn and stop in the ocean. They also use their “flippers” to control their body heat in changing water temperatures. The different environments of the dolphin and the human are what contribute to the vastly different uses of these similar bones. Dolphins have no need to write or type papers so they evolved to use their bones in a different way. Humans use their legs to propel them forward or turn so we evolved to use our arm and hand bones to do other meaningful tasks. There have been many studies done about the commonality between dolphins and humans, but I unfortunately could not find a definitive common ancestor. Many think the dolphin first lived on land while others think that humans came from the sea. If I were to make an educated guess, I think we could share an aquatic ancestor.

Penguins and fish fins are an example of analogous traits. Both of these animals have evolved to use fins that help them pilot through the waters. Penguins uses there flightless wings to dart through the water with extreme dexterity and precision. The common fish uses its fins in the same way. They use the fins on the side of their body to help them turn and move through the water. The locations of these structures are also very similar. Both animals have these fins on the side of their body.  A common ancestor could have possessed this trait or one very similar to it. That could explain the similarities between the dolphin fin and human arm as well. All of these structures share some similarities. However we know that the penguin and fish are not homologous. They most likely share this trait due to similar needs and environmental factors that cause both species to evolve and have fins.

 

DNA strand sentence

GGCATACCAAGGGAACGTAAGTGTTAGCACCTGATGGATCTAG