Adaptations to the cold

                The cold can have a profoundly negative impact on humans and disturb our homeostasis. Cold environments have the ability to drop our core body temperature down to fatal levels. This is called hypothermia and occurs when your core temperature reached 94 degrees Fahrenheit, or 34.4 degrees Celsius. These freezing conditions cause our bodies to try to adapt which in turn cause stress to our bodies. This disrupts our homeostasis because we are not relaxed and happy. Our bodies are not functioning properly; instead they are fighting for survival.   

               

               Humans have however found ways to adapt to the stress of the cold. A short term

adaptation that we use is shivering. When the body is cold the muscles start to convulse to continue the blood flow in those muscles. This helps us deal with the cold for a short amount of time and does not cause a change in our genes. An example of a facultative adaptation would be the narrowing of blood vessels near the skins surface. This is known as vasoconstriction and it helps to keep heat from leaving your body by reducing the peripheral
blood flow.
This can lead to frostbite if the body is left in the extreme conditions for too long however. Developmental adaptations could include an increased basal metabolic rate, higher levels of fat around vital organs, and the overall short and round shape of the body. Higher levels of fat and the body shape all help to retain heat in the body’s core. Cultural adaptations can be seen in many different ways. People who live in consistently cold weather use fire to keep warm. They also sleep in huddles with their bodies pushed up against each other to retain heat as

well. Their clothes are also designed to keep the cold out and the heat in. The picture to the right shows the style of clothes that keep the Inuit people warm. You can also see that their body type is shorter and rounder. All of these adaptations help the human body to survive in otherwise frightful conditions.

                The benefits of studying human variation is that we get to learn how our bodies work and change to better fit our environment. We are the only species that can survive in such varying conditions. That is something incredible and worth researching. Explorations like that help us to understand our body and its ability to adapt. From studying this we have been able to see the different adaptations form people living in subarctic regions to the deserts of Africa.

                You could use race to say that Inuit people are better adapted to the cold because of their race, but that is very limiting. You are taking away the importance of change over generations to adapt to that environment. They cannot survive the cold because they are Inuit. They can survive the cold because over generations their bodies have evolved and acclimated to the cold weather. The shorter and rounder shape took over in genes because they were better suited to the environmental stresses. To use race as a way to study human variation is a mistake. Race is a cultural and societal term. We are all more genetically similar than people tend to realize. Studying the environmental adaptations show you how and why a group of people changed.

                

Language Experiment

                In this language experiment we were told to speak with a partner using nothing but body language, hand movements, and facial expressions. Our partner could speak but we were not able to. In the second part of the experiment we were allowed to speak but not to use any facial expressions, fluctuation in our voice, or hand signals. The two parts of this experiment were extremely different from each other and the results were intriguing.

                Part 1 of this experiment was very difficult for me. It is tough to convey a thought to your partner without the use of words. It was like a game of charades at first. As it continued however my partner changed from asking complex questions to asking me yes or no questions. This was a lot easier for me to answer and for my partner to understand what I was trying to communicate. From a cultural standpoint when it comes down to describing complex ideas I believe the spoken language has a real advantage over the non-speaking form of communication. The speaker became a leader in our conversation. They would ask all the questions and I, the non-speaker, had to answer them. It was very difficult for me to ask my partner a question since most of the time they had to just guess what I was trying to say. For non-speakers there is too much guessing work involved, this makes it very difficult to convey a complex idea. From a speakers standpoint as well they might look down on the non-speakers as being dumber and less cultured. The speaker had to dumb everything down to a yes or no question for me to be able to answer. There are many people in our current culture that have difficulty speaking. Whether it is a young child just learning to talk, a foreign citizen who does not know the language, or a mutation in a person’s genes that make it difficult to speak, there is always a struggle. Unfortunately in our society there is not a very helpful reaction to this. People mostly just try to talk louder or slower to the other person. When talking to kids we dumb down what we say so we don’t confuse them. As a culture we tend to look down on those that don’t speak exactly like we do.

                Part 2 of this experiment was a little funnier to me. I could not last more than 1 minute without bursting out in laughter. I found my own monotone voice as funny and robotic. We rely so much on our emotions and express them in every aspect of our language. In taking that away from me, I tried to break it and ended up laughing so that I could show some type of emotion. My partner had much the same reaction as I did. We are not used to listening to someone talk with no emotion so we end up laughing at it. My partner also kept trying to make me break and laugh before the 15 minutes were up. We are able to judge a lot about a person and their personality through the way they talk and how they hold themselves. Body language is a huge insight into the person you are speaking to. You are able to tell if they are lying, or happy, or angry with you. Seeing the emotions of the person you are talking to enables you to change your own tone of voice as well. We are able to adapt and communicate better with whoever we are speaking to. However there are people who do have difficulty reading body language. Many people with mental disorders such as Asperger’s or autism have difficulty reading people’s body language. They can learn to imitate it in some situations but it may never come naturally to some. There are situations where it would be a benefit to not read into body language but it is very difficult for me to think of one. The only one I can really think of is from a law point of view. When listening to a testimony it may be more beneficial to not see the person talking. In this situation you may be able to hear the testimony better if you are not taken in by their bod language and how they are talking. If a woman is crying we are more likely to feel empathy for her but if you do not see her crying you may be able to make a better and less biased decision. 

The Piltdown Hoax

                The Piltdown Man was a fossil discovery that fooled scientist for decades. The fossils were found in the small village of Piltdown in England by a man names Charles Dawson in the early 1900’s. He was an amateur archeologist that specialized in fish fossils, not human evolution. Though there is not a definitive hoaxer he is the person most people blame for the deception. He also worked with a geologist named Sir Arthur Smith Woodward. These two sent their finds to the Britain Natural History Museum and it became a well-known and famous find. They claimed the fossils they found were a perfect connection between humans and apes. The jaw bone was more like an ape but the teeth had a very human like wear to them. This supported some scientists’ views that we evolved a bigger brain before we started to walk upright. This was a huge discovery for Britain as well given that they had not had any early human fossils in their country. The fossils gave them a sense of pride that they found the earliest human in their own homeland. The fossils were kept in the museum and were not available to many people for research. Later there was a chemical test developed to test the age of fossils more accurately. This test showed that the Piltdown Man was in fact much younger than advertised. This called for more research to be done on the fossils which revealed more and more inconsistences. The bones had been dyed to look older and the teeth had been filed down to look like human teeth. The jaw bone was in fact just a female orangutan that was less than 100 years old and the skull bones did not match at all. They were pieced together to make a perfect puzzle.  All of this came to light due to better dating and aging tests.

                The fraud had been brought to light so many years after the public and scientific community had accepted the fossils as truth that the aftermath was devastating. The country as a whole felt duped and embarrassed. There had been many scientists that studied the bones for their career and never knew they were faked. The discovery of the lies caused many to question the authenticity of scientist. People started to think that it was incredibly easy to trick them and therefore any finds they make must be fake somehow. This deception caused many to doubt the scientific method and its results. People tend to forget that it was science that proved it to be a fake as well. Yes the scientists were fooled but the technology advanced and they were able to see the lies.

                Scientist are curious by nature but they do make human mistakes as well. In this scenario people were so excited to finally find such a significant evolutionary discovery that they might have overlooked some key information. People had started to doubt the Piltdown Man before the discovery was made public but some scientists never wanted to believe it. In many situations the fossils gave the scientists exactly what they wanted. The finds supported their hypothesis and they did not want it to change. It is human of us to make mistakes but that does not make it wrong. As a species humans have a thirst for knowledge. We are curious about who we are and where we come from. It is this motivation that drives science. If you take away the “humanness” then you potentially take away the drive to learn more.

                The scientific technology had advanced enough to allow them to identify the fraud. The use of chemicals was able to show that the bones were much younger than the half a million years old they had originally thought. They also used microscopes to see the scratches made when filling down the teeth and canine. They were able to see the bones in better detail and see that they had been broken or shaped to fit together.

                We can all learn from this situation. When we are given information that seems too good to be true we might need to consider the source and do some additional research. Even if the information given to us perfectly supports our own endeavors, we need to make sure they are true. Science is ever changing and technologies are growing. This can help us or hurt us, we just need to be sure of the information we are given. 

Comparitive Primates

There are two suborder of primates; the Strepsirhini, which include lemurs and lorises, and the Haplorhini, which include tarsiers, monkeys, apes, and humans. All of these primates have many similarities and differences. In my post I will be focusing of the locomotor patterns that these primates exhibit.

       Lemurs live on the island of Madagascar and off the east coast of Africa. There is a lot of variation that lemurs show in their locomotor patterns. The picture showed here is of a ring-tailed lemur which happen to be terrestrial. There are a great deal more of arboreal lemurs given to the many high trees in Madagascar. This means that most lemurs prefer to be in the trees and travel that way. Even within the arboreal lemur family though there is some variation as to how they climb. Some are quadrupeds while others are vertical clingers and leapers. Quadrupeds use all four of their limbs to support their body weight while moving. Vertical clingers and leapers also use all four of their limbs but they use them to support their body weight vertically.The lemurs are the only non human primates on Madagascar, therefore they had no competition. This created a very unique set of primates.

        The spider monkey is a New World monkey. They mostly live in forested environments through southern Mexico and Central and South America. Because this is a mostly arboreal environment most of these monkeys live in the trees and some never touch the ground. The spider monkey is what they call a "semibrachiator". This means that this monkey uses both swinging by its arms and leaping to move about the forest. They also have a "prehensile tail" that they use as a kind of fifth arm. you can see this in the picture to the right. Due to the arboreal environment that they live in, these monkeys have adapted to live in the trees and use their limbs to help them. The spider monkey has even adapted to use its long tail to help him move.

     The Baboon is an Old World monkey. These monkeys are extremely spread out in the types of environments they live in. Baboons are part of the cercopithecines subfamily and are mainly found in Africa. The Baboon is a terrestrial monkey that only goes to the tress at night. They are quadrupedal so they walk on all four limbs. They lack a tail so they are very different from the spider monkey in their locomotor patterns. Given that the baboon does not spend a great deal of time in the trees it is understandable that they have adapted to their environment and are quadrupedal instead of using brachiation.

    Gibbons and Siamangs are considered the lesser apes because they are the smallest of the apes. They live in Southeast Asia along with the Orangutans. Gibbons travel almost exclusively using Brachiation. They use their arms to swing them from branch to branch. They are one of the only primates to excel at this form of travel. As you can see in the picture to the right, they have much longer arms. This helps them in their swinging ability. Their arms are so much longer in fact that when they do walk on the ground they need to walk bipedally. These apes have adapted and evolved to use their arms in the most beneficial way possible, which led to their extremely long arms.

 Chimpanzees, and Gorillas, are considered the great apes. The chimpanzees are found in equatorial Africa from the Atlantic Ocean to the Lake Tanganyika. Given their wide range of environments the chimpanzee walks quadrupedally but also occasionally climbs trees. Young chimpanzees have been known to brachiate on occasion. They are known as knuckle walkers as well as the gorillas given that when they walk on all four limbs they walk on their knuckles. Chimpanzees have also been known to walk bipedally if they are walking short distances while holding something.  They are built very similar to that of gorillas except that they have adapted in different ways. They spend more time in the trees and have adapted and evolved accordingly as you can see by their difference in locomotor patterns.

Homologous and Analogous Traits

Humans and dolphins share the same homologous trait in the structure of their bones in their outer limbs. These two structures perform very different tasks and are laid out in a different way but the key structure is the same. They share the same bones such as a humerus, ulna, and phalanges. While humans use their hands, and the bones in them, to grab items and write; the dolphin uses the bones in their pectoral fins to turn and stop in the ocean. They also use their “flippers” to control their body heat in changing water temperatures. The different environments of the dolphin and the human are what contribute to the vastly different uses of these similar bones. Dolphins have no need to write or type papers so they evolved to use their bones in a different way. Humans use their legs to propel them forward or turn so we evolved to use our arm and hand bones to do other meaningful tasks. There have been many studies done about the commonality between dolphins and humans, but I unfortunately could not find a definitive common ancestor. Many think the dolphin first lived on land while others think that humans came from the sea. If I were to make an educated guess, I think we could share an aquatic ancestor.

Penguins and fish fins are an example of analogous traits. Both of these animals have evolved to use fins that help them pilot through the waters. Penguins uses there flightless wings to dart through the water with extreme dexterity and precision. The common fish uses its fins in the same way. They use the fins on the side of their body to help them turn and move through the water. The locations of these structures are also very similar. Both animals have these fins on the side of their body.  A common ancestor could have possessed this trait or one very similar to it. That could explain the similarities between the dolphin fin and human arm as well. All of these structures share some similarities. However we know that the penguin and fish are not homologous. They most likely share this trait due to similar needs and environmental factors that cause both species to evolve and have fins.

 

DNA strand sentence

GGCATACCAAGGGAACGTAAGTGTTAGCACCTGATGGATCTAG